| Detail of Probeset Mtr.51237.1.S1_a_at in Chip AffyMedicago |
| Probeset ID |
Mtr.51237.1.S1_a_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|834.m00011 /FEA=mRNA /DEF=conserved hypothetical protein protein CIT987SK_2A8_1 AC130808.26.111 44552 47675 mth2-34k9 01/13/05 |
| Mapped public sequence ID |
IMGAG|834.m00011 |
| Gene Ontology |
GO:0005515 GO:0005847 GO:0006378 GO:0006379 GO:0016180 GO:0032039 |
| KEGG |
K07041 K23916 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
gtttctcatgtgaaaagtctttctcagtttcgtattatactgaagctgaaactttaaaag
taccttgtcaaaaggaaagttcagagttgaagatgagtttctcatgtgaaaagtctttct
cagtttcgtat |