| Detail of Probeset Mtr.51258.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.51258.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|834.m00020 /FEA=mRNA /DEF=Annexin; Annexin, type IV AC130808.26.201 87644 84799 mth2-34k9 01/13/05 |
| Mapped public sequence ID |
IMGAG|834.m00020 |
| Gene Ontology |
GO:0003779 GO:0005509 GO:0005543 GO:0005544 GO:0005575 GO:0008150 GO:0005515 GO:0005634 GO:0005635 GO:0005654 GO:0005737 GO:0006955 |
| KEGG |
K01124 K14180 K25596 |
| Transporter |
1.A.31 1.A.31.1.1 1.A.31.1.2 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atggaaatcgttggaatcaatgaggatgcactcacccgtgtgattgtcactagggctgag
aaggacttggaggacataaaaaaggtctattacaagagaaatagtgtccaacttgagcat
gcagtggccaaaaaaacttcaggagattacaagaaatttctccttactctgatggg |
