Detail of Probeset Mtr.51363.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.51363.1.S1_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|750.m00019 /FEA=mRNA /DEF=hypothetical protein AC122729.23.191 67167 66920 mth1-62g18 01/13/05 |
Mapped public sequence ID |
IMGAG|750.m00019 |
Gene Ontology |
GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 |
KEGG |
K07497 |
Transporter |
|
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
TCMT60110 BG647869
TCMT44885 |
Target sequence |
ggaaaggaaggctctccattacaaactagaaatatctagaaacaaagaaaagtctagaga
tatggatactctagtacataagcctagaaggatcta |