| Detail of Probeset Mtr.51367.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.51367.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|882.m00028 /FEA=mRNA /DEF=Myosin head, motor region; Myosin, N-terminal, SH3-like; AAA ATPase AC135798.31.281 114560 118130 mth2-31c16 01/13/05 |
| Mapped public sequence ID |
IMGAG|882.m00028 |
| Gene Ontology |
GO:0000146 GO:0000331 GO:0000910 GO:0001931 GO:0003774 GO:0005524 GO:0005826 GO:0005856 GO:0005938 GO:0006928 GO:0006935 GO:0008104 GO:0016459 GO:0016460 GO:0030038 GO:0030554 GO:0030837 GO:0030866 GO:0030898 GO:0031034 GO:0031154 GO:0031270 GO:0032060 GO:0032982 GO:0033275 GO:0034461 GO:0042641 GO:0042803 GO:0043531 GO:0046847 GO:0051015 GO:0060328 |
| KEGG |
K10352 K10357 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tgagcaggatgctatcttccgtgttgtagctgcaattcttcatctcggaaacattgactt
cgtcaaagggagcgaatttgattcttccaaattgaaagatgacaaatcactctaccacct
tcgaacagttgccgagttattcatgtgtgatgagaaatcgctagaagactcactttgcca
gcgcgtcattgttacccctgatggaaacattacgaaaccactagaccctgatgcagcttc
tttgagccgagatgc |