| Detail of Probeset Mtr.51429.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.51429.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|752.m00011 /FEA=mRNA /DEF=LysM domain-containing receptor-like kinase 7-related AC123570.7.111 58484 60079 mth2-33l22 01/13/05 |
| Mapped public sequence ID |
IMGAG|752.m00011 |
| Gene Ontology |
GO:0004674 GO:0005515 GO:0005634 GO:0005737 GO:0005829 GO:0005887 GO:0007249 |
| KEGG |
K00924 |
| Transporter |
1.A.26 1.A.26.1.1 |
| Transcription Factor |
WRKY |
| Mapped unigene in the TRICHOME database |
TCMT57935 |
| Target sequence |
atattcctgggaaagaccaaaatcgtaactatgtgccttttcacactagcactggaggtt
ag |