Detail of Probeset Mtr.51511.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.51511.1.S1_at
Species Medicago truncatula
Annotation IMGAG|886.m00017 /FEA=mRNA /DEF=Histone-fold/TFIID-TAF/NF-Y; Histone core; Transcription factor CBF/NF-Y/archaeal histone AC136138.30.161 82764 82405 mth2-8f9 01/13/05
Mapped public sequence ID IMGAG|886.m00017
Gene Ontology GO:0003677 GO:0003700 GO:0003704 GO:0005634 GO:0006109 GO:0006350 GO:0006355 GO:0016563 GO:0016602 GO:0030447 GO:0030448 GO:0030528 GO:0033217
KEGG K08066
Transporter
Transcription Factor CCAAT-HAP5
Mapped unigene in the TRICHOME database N/A
Target sequence attctgattccactgatgataccactgtcatgcaaatggaaactatgaat