Detail of Probeset Mtr.51515.1.S1_x_at in Chip AffyMedicago
Probeset ID Mtr.51515.1.S1_x_at
Species Medicago truncatula
Annotation IMGAG|886.m00022 /FEA=mRNA /DEF=hypothetical protein AC136138.30.211 107815 106019 mth2-8f9 01/13/05
Mapped public sequence ID IMGAG|886.m00022
Gene Ontology GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 GO:0005575 GO:0005634
KEGG K00140 K04773 K07497 K15001 K22300
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence agctcacacctgtttattttcctttgctttcggtcgagtgaccagttcgaatccaagaac
aactcgtacctatctacttttccatga