| Detail of Probeset Mtr.51608.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.51608.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|907.m00005 /FEA=mRNA /DEF=Plant lipid transfer protein/Par allergen; Plant lipid transfer/seed storage/trypsin-alpha amylase inhibitor AC137510.33.51 16678 18066 mth2-8m7 01/13/05 |
| Mapped public sequence ID | IMGAG|907.m00005 |
| Gene Ontology | GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 |
| KEGG | K00140 K15001 K22300 |
| Transporter | |
| Transcription Factor | C2C2-CO-like |
| Mapped unigene in the TRICHOME database | TCMS41103 TCMT46447 EY476676 |
| Target sequence | ggctagtctcagaatcatcacttttgtgtcattgatggtgttgttgatgatcaacacaac |