| Detail of Probeset Mtr.51685.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.51685.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|992.m00023 /FEA=mRNA /DEF=Terpenoid cylases/protein prenyltransferase alpha-alpha toroid AC140915.6.221 87714 88168 mth2-10l24 01/13/05 |
| Mapped public sequence ID | IMGAG|992.m00023 |
| Gene Ontology | GO:0005575 GO:0019745 GO:0042300 GO:0042561 |
| KEGG | K01853 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | BI265441 |
| Target sequence | gagtttgatccaaatgctggtacttctgaggagaga |