| Detail of Probeset Mtr.51873.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.51873.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|892.m00026 /FEA=mRNA /DEF=Ras GTPase; Ras small GTPase, Ras type; Ras small GTPase, Rab type; Ras small GTPase, Rho type; Lumazine-binding protein; Small GTP-binding protein domain AC136504.23.261 104551 106438 mth2-13m6 01/13/05 |
| Mapped public sequence ID | IMGAG|892.m00026 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | ttggcacaaagcttgttttactgaagagtaacttcttgcttccggtaatgg |