Detail of Probeset Mtr.51878.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.51878.1.S1_at |
Species |
Medicago truncatula |
Annotation |
IMGAG|892.m00007 /FEA=mRNA /DEF=AAA ATPase; ABC transporter related AC136504.23.71 17184 20936 mth2-13m6 01/13/05 |
Mapped public sequence ID |
IMGAG|892.m00007 |
Gene Ontology |
GO:0005524 GO:0005840 GO:0006412 GO:0006954 GO:0008135 GO:0042626 GO:0043023 GO:0043024 |
KEGG |
K06184 |
Transporter |
3.A.1 3.A.1.120 3.A.1.120.1 3.A.1.120.4 |
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
N/A |
Target sequence |
cgtgttgccatcgttgggcctaatggtgctggaaaatctacactgctgaatcttctagc |