| Detail of Probeset Mtr.51992.1.S1_x_at in Chip AffyMedicago | |
| Probeset ID | Mtr.51992.1.S1_x_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|768.m00026 /FEA=mRNA /DEF=hypothetical protein AC124955.34.261 110144 110308 mth2-12l24 01/13/05 |
| Mapped public sequence ID | IMGAG|768.m00026 |
| Gene Ontology | GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 GO:0005575 GO:0008150 GO:0016798 GO:0003674 GO:0003690 GO:0003700 GO:0008134 GO:0008283 GO:0009303 GO:0005634 GO:0033554 |
| KEGG | K01188 K01198 K05349 K07497 K12697 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | agcttaggcagagtgcatgtcatatttcgtgtttcgaccttt |