| Detail of Probeset Mtr.52029.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.52029.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|848.m00006 /FEA=mRNA /DEF=hypothetical protein AC134242.17.61 20067 19873 mth2-10p20 01/13/05 |
| Mapped public sequence ID |
IMGAG|848.m00006 |
| Gene Ontology |
GO:0004826 GO:0005625 GO:0005737 GO:0009328 GO:0003689 GO:0005515 GO:0005524 GO:0005654 GO:0005663 GO:0006272 GO:0006297 GO:0006298 GO:0016887 GO:0031389 GO:0031391 |
| KEGG |
K01889 K10756 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atggagtgcttacatagtgttcagatccggacaaaatcgtgtcacgatttcccaaattgt
gacacgtttggtgcgtacgacccaaggtatgaccaaccttatcctgaaaacttgctcagc
aagccgaaaatcgtgtcacgttttcccaaaatcgtgtcacgattggacaccctaaaaaca
atgttcactgcctaa |
