| Detail of Probeset Mtr.52094.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.52094.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|769.m00020 /FEA=mRNA /DEF=Ribosomal protein L14, bacterial and organelle form; Ribosomal protein L14b/L23e; Ribosomal protein S11 AC124957.18.201 114662 115387 mth2-15k14 01/13/05 |
| Mapped public sequence ID |
IMGAG|769.m00020 |
| Gene Ontology |
GO:0003735 GO:0006412 GO:0042254 |
| KEGG |
K02874 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT42564 |
| Target sequence |
ataaaaggtcccgttagtgatctcggttcagtgagtcctttcttgcgtgatgaactgttg
gcaccagtcttccatttcatgggtagagcccataagtgtgaactgtacaagt |
