| Detail of Probeset Mtr.52232.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.52232.1.S1_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|810.m00022 /FEA=mRNA /DEF=TIR; Disease resistance protein; NB-ARC; Leucine-rich repeat; AAA ATPase AC126790.38.211 100238 104040 mth2-10d14 01/13/05 |
| Mapped public sequence ID | IMGAG|810.m00022 |
| Gene Ontology | GO:0005515 GO:0005575 GO:0006605 GO:0008150 GO:0016323 |
| KEGG | K06883 |
| Transporter | |
| Transcription Factor | WRKY |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | atatttattcttccgaaaggcaatgagtatgccacaagtgtcaatgtttttgt |