Detail of Probeset Mtr.52232.1.S1_x_at in Chip AffyMedicago
Probeset ID Mtr.52232.1.S1_x_at
Species Medicago truncatula
Annotation IMGAG|810.m00022 /FEA=mRNA /DEF=TIR; Disease resistance protein; NB-ARC; Leucine-rich repeat; AAA ATPase AC126790.38.211 100238 104040 mth2-10d14 01/13/05
Mapped public sequence ID IMGAG|810.m00022
Gene Ontology GO:0005515 GO:0005575 GO:0006605 GO:0008150 GO:0016323
KEGG K06883
Transporter
Transcription Factor WRKY
Mapped unigene in the TRICHOME database N/A
Target sequence atatttattcttccgaaaggcaatgagtatgccacaagtgtcaatgtttttgtgaatgga
tatgaaattgagataggttgttattggtctctctttttcttcacggacca