| Detail of Probeset Mtr.52232.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.52232.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|810.m00022 /FEA=mRNA /DEF=TIR; Disease resistance protein; NB-ARC; Leucine-rich repeat; AAA ATPase AC126790.38.211 100238 104040 mth2-10d14 01/13/05 |
| Mapped public sequence ID |
IMGAG|810.m00022 |
| Gene Ontology |
GO:0005515 GO:0005575 GO:0006605 GO:0008150 GO:0016323 |
| KEGG |
K06883 |
| Transporter |
|
| Transcription Factor |
WRKY |
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atatttattcttccgaaaggcaatgagtatgccacaagtgtcaatgtttttgtgaatgga
tatgaaattgagataggttgttattggtctctctttttcttcacggacca |