| Detail of Probeset Mtr.52284.1.S1_x_at in Chip AffyMedicago |
| Probeset ID |
Mtr.52284.1.S1_x_at |
| Species |
Medicago truncatula |
| Annotation |
IMGAG|854.m00030 /FEA=mRNA /DEF=LQGC hypothetical protein AC135102.15.301 116911 117369 mth2-8m3 01/13/05 |
| Mapped public sequence ID |
IMGAG|854.m00030 |
| Gene Ontology |
GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 GO:0006508 |
| KEGG |
K01342 K01362 K07497 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
ES611194 EX527320
|
| Target sequence |
agctgcccagaattttgttgtgggagagcttcggctctggaatgcttagtcgttcaaagt
ggt |
