| Detail of Probeset Mtr.52362.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.52362.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | IMGAG|857.m00010 /FEA=mRNA /DEF=hypothetical protein AC135161.11.101 30707 30000 mth2-30k24 01/13/05 |
| Mapped public sequence ID | IMGAG|857.m00010 |
| Gene Ontology | GO:0000165 GO:0004709 GO:0005515 GO:0005524 GO:0005938 GO:0006468 GO:0009653 GO:0030587 |
| KEGG | K04421 K08282 |
| Transporter | |
| Transcription Factor | WRKY |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | ccgccttttgggagcgaattacaggtcttgaccagtttaacaca |