| Detail of Probeset Mtr.5497.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.5497.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | BF632880 /FEA=mRNA /DEF=similar to UP|Q68YN6 (Q68YN6) Cystathionine gamma synthase (Fragment), partial (65%) |
| Mapped public sequence ID | BF632880 |
| Gene Ontology | GO:0004121 GO:0004123 GO:0005737 GO:0006534 GO:0009086 GO:0003962 |
| KEGG | K01739 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS41003 TCMT58845 BF632880 |
| Target sequence | atagtcttgctgatggcgctggttccagctggtggacatcttgtgactactactgattgt |