| Detail of Probeset Mtr.5536.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.5536.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | BF634521 /FEA=mRNA /DEF=similar to SP|O22769|NUHM_ARATH NADH-ubiquinone oxidoreductase 24 kDa subunit, mitochondrial precursor . {Arabidopsis thaliana;} , partial (78%) |
| Mapped public sequence ID | BF634521 |
| Gene Ontology | GO:0005739 GO:0005747 GO:0006120 GO:0007399 GO:0008137 GO:0009055 GO:0048738 |
| KEGG | K01923 K03943 |
| Transporter | 3.D.1 3.D.1.2.1 3.D.1.3.1 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40320 TCMT40915 BF634521 |
| Target sequence | tatatctcactatccatccaactataagcaatctgcagtgattcctctgctggatcttgc |