Detail of Probeset Mtr.6098.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.6098.1.S1_at
Species Medicago truncatula
Annotation BI268324 /FEA=mRNA /DEF=weakly similar to PIR|B96660|B96660 protein F2K11.18 [imported] - Arabidopsis thaliana {Arabidopsis thaliana;} , partial (3%)
Mapped public sequence ID BI268324
Gene Ontology GO:0004008 GO:0005507 GO:0005515 GO:0005524 GO:0005624 GO:0005770 GO:0005802 GO:0005887 GO:0006825 GO:0006878 GO:0006882 GO:0007595 GO:0015677 GO:0015680 GO:0016020 GO:0016023 GO:0016323 GO:0043682 GO:0046688 GO:0048471 GO:0051208 GO:0002164 GO:0005375 GO:0005737 GO:0005886 GO:0048066 GO:0048085
KEGG K01533
Transporter 3.A.3 3.A.3.5.3 3.A.3.5.6
Transcription Factor
Mapped unigene in the TRICHOME database BI268324  
Target sequence tgacgcacgcagtcacgcactcttattctcgattcttccgtagcaaatttcctacaaa