Detail of Probeset Mtr.615.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.615.1.S1_at
Species Medicago truncatula
Annotation 1458.m00028 /FEA=mRNA /DEF=AC148398.10 27320 26086 mth2-24c23
Mapped public sequence ID 1458.m00028
Gene Ontology GO:0000943 GO:0003723 GO:0003887 GO:0003964 GO:0004540 GO:0005515 GO:0008233 GO:0032197 GO:0000003 GO:0009792 GO:0040010 GO:0040035
KEGG K00140 K07497 K09873 K11647 K15001 K22300
Transporter
Transcription Factor PHD
Mapped unigene in the TRICHOME database TCMT47889  
Target sequence ataagcttcaaattcattcccatcttgagtgtacaaattctgcaggcatggctgttgttt
tgtcttgtagcgtagacagaaaacagagtagtggaggatcaaacgtagcttctggtgaa