| Detail of Probeset Mtr.6191.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.6191.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
BI273321 /FEA=mRNA /DEF= |
| Mapped public sequence ID |
BI273321 |
| Gene Ontology |
GO:0000146 GO:0000149 GO:0001726 GO:0001750 GO:0003774 GO:0003779 GO:0005509 GO:0005515 GO:0005516 GO:0005524 GO:0005737 GO:0005794 GO:0005813 GO:0005882 GO:0005925 GO:0006582 GO:0006887 GO:0007268 GO:0007601 GO:0008021 GO:0016459 GO:0017075 GO:0017157 GO:0030048 GO:0030050 GO:0030073 GO:0030141 GO:0030318 GO:0030424 GO:0031585 GO:0031941 GO:0031987 GO:0032252 GO:0032400 GO:0032402 GO:0042438 GO:0042470 GO:0042476 GO:0042552 GO:0042640 GO:0042641 GO:0042642 GO:0042759 GO:0043005 GO:0043008 GO:0043025 GO:0043473 GO:0046982 GO:0048066 GO:0048306 GO:0050808 GO:0050885 GO:0051010 GO:0051643 GO:0060001 |
| KEGG |
K10357 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
tccgcacgaggatacaaatgtcttcttcattggcatgcatttgaatctgagcgcacagcc
atatttgattacataattgatggaatcaatgaagtcataaaagtcagagacgatgacatt
gtcttgccatnnnggctgtccaatacctccgcacttgnttgccttttacagagaaatgtt
cgttcaaatggttttttaactaccacagctcaacgttatgctggatcatctggcttgacc
agccggattgggcat |