Detail of Probeset Mtr.6366.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.6366.1.S1_at
Species Medicago truncatula
Annotation BQ140972 /FEA=mRNA /DEF=similar to UP|Q39834 (Q39834) Clathrin heavy chain, partial (7%)
Mapped public sequence ID BQ140972
Gene Ontology GO:0005515 GO:0005624 GO:0005739 GO:0005886 GO:0007030 GO:0030117 GO:0030118 GO:0030315 GO:0030506 GO:0030669 GO:0031072 GO:0042277 GO:0042383 GO:0005198 GO:0006886
KEGG K04646
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database BQ140972  
Target sequence aagctgtttccagatcttgtactgatttgaactccgattcaaccaccgctgtagatctca
atctccgatccatttcaccatggcgg