| Detail of Probeset Mtr.6648.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.6648.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | BQ153446 /FEA=mRNA /DEF=similar to UP|Q8GTJ0 (Q8GTJ0) Xyloglucan endotransglycosylase, partial (30%) |
| Mapped public sequence ID | BQ153446 |
| Gene Ontology | GO:0005619 GO:0006112 GO:0007047 GO:0009277 GO:0009986 GO:0016810 GO:0030445 GO:0030446 GO:0030476 |
| KEGG | K08235 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40659 TCMT51812 BQ153446 |
| Target sequence | gtcacaacatattatctatcttctcttggtgatgctcatgatgaaatagattttgaattt |