| Detail of Probeset Mtr.6697.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.6697.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
CX517184 /FEA=mRNA /DEF=similar to PIR|T01259|T01259 AMP deaminase homolog F16M14.21 - Arabidopsis thaliana {Arabidopsis thaliana;} , partial (5%) |
| Mapped public sequence ID |
CX517184 |
| Gene Ontology |
GO:0003876 GO:0005575 GO:0005625 GO:0006163 GO:0009167 GO:0030435 |
| KEGG |
K01490 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT58283 |
| Target sequence |
aggctgtgtcataggttctacttccttacttcctgttcttcctttttcatagtgtgtgac
ctgcagattttggctgttttcatattgcaatttgacgattctcgatctgttccaaagttg
actgaatgtgtgttgttcact |
