Detail of Probeset Mtr.6962.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.6962.1.S1_at
Species Medicago truncatula
Annotation CX531902 /FEA=mRNA /DEF=similar to UP|Q8L7Y8 (Q8L7Y8) AT3g23670/MDB19_16 (Phragmoplast-associated kinesin-related protein 1-like protein), partial (6%)
Mapped public sequence ID CX531902
Gene Ontology GO:0000003 GO:0002119 GO:0003677 GO:0005813 GO:0005873 GO:0006942 GO:0007067 GO:0007270 GO:0007631 GO:0008089 GO:0008283 GO:0016192 GO:0018996 GO:0030421 GO:0030516 GO:0040010 GO:0040011 GO:0040018 GO:0043113 GO:0045055 GO:0045887 GO:0005515
KEGG K10400
Transporter
Transcription Factor
Mapped unigene in the TRICHOME database CX531902  
Target sequence atcactctctctatcgccagaatgaagcacttcatg