| Detail of Probeset Mtr.7026.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.7026.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
CX534535 /FEA=mRNA /DEF=weakly similar to UP|Q8VYI3 (Q8VYI3) At1g76150/T23E18_38, partial (28%) |
| Mapped public sequence ID |
CX534535 |
| Gene Ontology |
GO:0000038 GO:0003857 GO:0005515 GO:0005739 GO:0005777 GO:0005782 GO:0006635 GO:0008203 GO:0030283 GO:0060009 |
| KEGG |
K00022 K08078 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
CX534535 |
| Target sequence |
cttccagctgccatgtaaggtaaaatgatctgatgcaagtaagtgatgaagattanattt
tgtatgactaaattctgtctatctaatttgcattagattcttttaaacaaacttcttcga
ccccaaaatatctctccatttccacacctgacctttacaaatacaa |