| Detail of Probeset Mtr.7389.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.7389.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | TC111198 /FEA=mRNA /DEF=similar to GB|AAM62838.1|21553745|AY085617 Yippee-like protein {Arabidopsis thaliana;} , partial (72%) |
| Mapped public sequence ID | TC111198 |
| Gene Ontology | GO:0003674 GO:0005575 GO:0008150 |
| KEGG | K01802 K20038 K25643 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | CO515854 BF635599 TCMT58148 DW015758 |
| Target sequence | cagacacacacaccgattcatgggtagattgtttgtgatcaatttggaaggtaagattta |