Detail of Probeset Mtr.7403.1.S1_at in Chip AffyMedicago |
Probeset ID |
Mtr.7403.1.S1_at |
Species |
Medicago truncatula |
Annotation |
TC111393 /FEA=mRNA /DEF=similar to UP|IRT3_ARATH (Q8LE59) Fe(II) transport protein 3, chloroplast precursor (Iron-regulated transporter 3), partial (7%) |
Mapped public sequence ID |
TC111393 |
Gene Ontology |
GO:0000006 GO:0000007 GO:0005886 GO:0005887 GO:0006830 GO:0006831 GO:0042254 |
KEGG |
|
Transporter |
2.A.5 2.A.5.1.2 2.A.5.1.3 |
Transcription Factor |
|
Mapped unigene in the TRICHOME database |
TCMT58658 |
Target sequence |
gcaatatgggcatgagcctttcttccaattatagttttttttttttttttttttttaggg
atcttccaattcaattttggtagatctgtctttctct |