| Detail of Probeset Mtr.7644.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.7644.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
AJ845437 /FEA=mRNA /DEF=homologue to PIR|S21313|S21313 ADP,ATP carrier protein - Arabidopsis thaliana (fragment) {Arabidopsis thaliana;} , partial (27%) |
| Mapped public sequence ID |
AJ845437 |
| Gene Ontology |
GO:0005471 GO:0005624 GO:0005739 GO:0005743 GO:0006783 GO:0006793 GO:0006839 GO:0009060 GO:0009061 GO:0015866 GO:0015867 GO:0043284 GO:0055085 |
| KEGG |
K05863 |
| Transporter |
2.A.29 2.A.29.1.1 2.A.29.1.2 |
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
TCMT40769 AJ845437
|
| Target sequence |
tacttcggattgtatgattccctcaaaccagttcttctcactggaaaattgcaggatagc
tttttcgccagctttgcgcttggatggctcattaccaatggtgcaggtctagcatcatac
cctattgacactgttaggaga |
