Detail of Probeset Mtr.7675.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.7675.1.S1_at
Species Medicago truncatula
Annotation AJ847003 /FEA=mRNA /DEF=homologue to UP|Q5Z5X8 (Q5Z5X8) Ankyrin-like, partial (8%)
Mapped public sequence ID AJ847003
Gene Ontology GO:0000028 GO:0003697 GO:0003723 GO:0005515 GO:0005634 GO:0005730 GO:0005739 GO:0006364
KEGG K11294 K11304
Transporter 3.A.8 3.A.8.1.1
Transcription Factor
Mapped unigene in the TRICHOME database N/A
Target sequence gtgtcaggtgaattcttgacattcccaggaggtggcactcaattcattcatggagctcta
cactacattgattttctccaacaggtagttgcaa