| Detail of Probeset Mtr.7754.1.S1_s_at in Chip AffyMedicago |
| Probeset ID |
Mtr.7754.1.S1_s_at |
| Species |
Medicago truncatula |
| Annotation |
AL382470 /FEA=mRNA /DEF=similar to UP|Q40316 (Q40316) Vestitone reductase, partial (48%) |
| Mapped public sequence ID |
AL382470 |
| Gene Ontology |
GO:0003674 GO:0003824 GO:0005575 GO:0008150 GO:0044237 GO:0045335 GO:0051287 |
| KEGG |
K08695 K09753 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
AL382470 |
| Target sequence |
ttcaacgctgatctttgcaacccagaaagtttcgatgcagcaattgaagggtgcattgga
atattccacacagctactccaattgattttgaagagaacgaacgggaggaaatagtgaca
|