| Detail of Probeset Mtr.784.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.784.1.S1_at |
| Species | Medicago truncatula |
| Annotation | 1482.m00050 /FEA=mRNA /DEF=AC150446.8 94674 95604 mth2-101n14 weakly similar to TIGR_Ath1|At4g30690-GOpep .1 68411.m03973 expressed protein translation initiation factor, IF3 - Listeria, partial (45%) |
| Mapped public sequence ID | 1482.m00050 |
| Gene Ontology | |
| KEGG | |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | N/A |
| Target sequence | aataatgaattacaggcaagaactcagtccgtcctga |