| Detail of Probeset Mtr.848.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.848.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | 1490.m00030 /FEA=mRNA /DEF=AC151708.6 49615 46639 mth2-15h5 similar to UP|O04428 (O04428) Hypothetical protein |
| Mapped public sequence ID | 1490.m00030 |
| Gene Ontology | GO:0004462 GO:0005515 GO:0006749 GO:0016151 GO:0019243 GO:0005575 GO:0005975 |
| KEGG | K01759 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT42597 AW287960 ES611227 |
| Target sequence | acaaattggttgagcacattcgtgctaaaggtggaaacatcacaagggaggctggtccag |