| Detail of Probeset Mtr.8495.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | Mtr.8495.1.S1_s_at |
| Species | Medicago truncatula |
| Annotation | TC100386 /FEA=mRNA /DEF=homologue to UP|O22639 (O22639) Endoplasmic reticulum HSC70-cognate binding protein precursor, partial (39%) |
| Mapped public sequence ID | TC100386 |
| Gene Ontology | GO:0005515 GO:0005634 GO:0005783 GO:0005793 GO:0006916 GO:0006983 GO:0008303 GO:0009986 GO:0030176 GO:0042149 GO:0043022 GO:0043027 GO:0043154 GO:0048471 GO:0005811 GO:0009408 GO:0016246 GO:0016887 GO:0030431 |
| KEGG | K03283 K09490 |
| Transporter | 1.A.33 1.A.33.1.1 1.A.33.1.3 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMT40660 TCMT40121 BQ136710 |
| Target sequence | gtatcacaccatcatgggtttctttcaccgatgatgagagattgattggggaggccgcaa |