Detail of Probeset Mtr.8814.1.S1_at in Chip AffyMedicago
Probeset ID Mtr.8814.1.S1_at
Species Medicago truncatula
Annotation TC101469 /FEA=mRNA /DEF=similar to UP|Q8LKS6 (Q8LKS6) Long chain acyl-CoA synthetase 6 , partial (55%)
Mapped public sequence ID TC101469
Gene Ontology GO:0004467 GO:0005575 GO:0005829 GO:0007586 GO:0046320 GO:0001676 GO:0005515 GO:0005634 GO:0005739 GO:0007405 GO:0007584 GO:0043434
KEGG K01897
Transporter 2.A.1 2.A.1.42.2 9.B.17.1.4
Transcription Factor
Mapped unigene in the TRICHOME database TCMT53056  
Target sequence aacataccattgaaaggatcctgcgatttcttgttgtattgtgttgtagt