| Detail of Probeset Mtr.9025.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.9025.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC102137 /FEA=mRNA /DEF=similar to UP|Q8H2B9 (Q8H2B9) 60s acidic ribosomal protein, complete |
| Mapped public sequence ID | TC102137 |
| Gene Ontology | GO:0003735 GO:0005829 GO:0005840 GO:0006412 GO:0006414 GO:0022625 |
| KEGG | K02943 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | EX525779 TCMT53167 AA660895 |
| Target sequence | gatcatcgctgcttatatgttggctgttttgggcggtaactctgccccttccgctgatga |