| Detail of Probeset Mtr.9048.1.S1_at in Chip AffyMedicago | |
| Probeset ID | Mtr.9048.1.S1_at |
| Species | Medicago truncatula |
| Annotation | TC102217 /FEA=mRNA /DEF=similar to UP|VATF_ARATH (Q9ZQX4) Probable vacuolar ATP synthase subunit F (V-ATPase F subunit) (Vacuolar proton pump F subunit) (V-ATPase 14 kDa subunit) , partial (98%) |
| Mapped public sequence ID | TC102217 |
| Gene Ontology | GO:0000003 GO:0002119 GO:0009792 GO:0018996 GO:0040007 GO:0040011 GO:0042625 |
| KEGG | K02151 |
| Transporter | 3.A.2 3.A.2.2.3 |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | TCMS40267 EX521871 TCMT42726 BF635633 |
| Target sequence | gattgctgacgaggataccatagttgggtttcttttggctggagtgggaaacgttgacat |