| Detail of Probeset Mtr.969.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.969.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
1505.m00046 /FEA=mRNA /DEF=AC155099.1 112098 113088 mth2-144f20 similar to UP|ERFA_ARATH (Q39097) Eukaryotic peptide chain release factor subunit 1-1 (eRF1-1) (Eukaryotic release factor 1-1) (Omnipotent suppressor protein 1 homolog 1) (SUP1 homolog 1) |
| Mapped public sequence ID |
1505.m00046 |
| Gene Ontology |
GO:0000910 GO:0003747 GO:0005575 GO:0005829 GO:0006415 GO:0016149 GO:0018444 |
| KEGG |
K03265 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
atcgacatcaaactatcttaccgggaatgaaccatatgatgagcaacaaccaatctcgtg
ttgccaaga |