| Detail of Probeset Mtr.9801.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Mtr.9801.1.S1_at |
| Species |
Medicago truncatula |
| Annotation |
TC104432 /FEA=mRNA /DEF=similar to UP|Q9M009 (Q9M009) Aldose reductase-like protein, partial (66%) |
| Mapped public sequence ID |
TC104432 |
| Gene Ontology |
GO:0004032 GO:0005575 GO:0005829 GO:0006928 GO:0006979 GO:0031158 GO:0042593 |
| KEGG |
K00002 K00100 |
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
accagatcaggtagctcacaagcattggtcgaaatagttccgatttgataaatagatctt
taaaatgttaatttcatccaaaatgtccatccgttgacttctactattggagctatgacg
tggaacattacccaatatgctacattgcatgttcatccc |