| Detail of Probeset MtrAffx.53600.1.S1_s_at in Chip AffyMedicago | |
| Probeset ID | MtrAffx.53600.1.S1_s_at |
| Species | Medicago sativa |
| Annotation | gi|5326745:272-435 /TID=MtrAffx.53600.1 /CNT=1 /FEA=rRNA /TIER=ConsEnd /STK=0 /NOTE=sequence(s) not in UniGene /DEF=Medicago truncatula internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence |
| Mapped public sequence ID | 272-435 |
| Gene Ontology | GO:0003674 GO:0005739 GO:0043457 GO:0004565 GO:0005515 GO:0005990 |
| KEGG | K01190 |
| Transporter | |
| Transcription Factor | |
| Mapped unigene in the TRICHOME database | EX522035 TCMS40010 CO514957 TCMT41958 BQ150703 |
| Target sequence | tgactctcggcaacggatatctaggctcttgcatcgatgaagaacgtagcgaaatgcgat |