| Detail of Probeset Sme.5540.1.S1_at in Chip AffyMedicago |
| Probeset ID |
Sme.5540.1.S1_at |
| Species |
Sinorhizobium meliloti |
| Annotation |
TIGR|NT01SM2930 /FEA=mRNA /DEF=Contains similarity to gb|U19615 LET 858 gene from Caenorhabditis elegans. ESTs gb|AI995150, gb|H76674 and gb|R84035 come from this gene. {Sinorhizobium meliloti 1021} |
| Mapped public sequence ID |
TIGR|NT01SM2930 |
| Gene Ontology |
|
| KEGG |
|
| Transporter |
|
| Transcription Factor |
|
| Mapped unigene in the TRICHOME database |
N/A |
| Target sequence |
gttccgacgccttgagaaaggcgcaacggaaagggcaggacttgagcaccgagcatggcg
atgcccgcgaggcggacgatcgcagcattctgcgcgggaagaatcaggagagcaggcatc
acaagggcgccgg |
