Detail of EST/Unigene AA660182 |
Acc. | AA660182 |
Internal Acc. | 00022 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Citrate synthase 3, peroxisomal OS=Arabidopsis thaliana E-value=3e-22; Citrate synthase, glyoxysomal OS=Cucurbita maxima E-value=6e-22; Citrate synthase 2, peroxisomal OS=Arabidopsis thaliana E-value=3e-19; Citrate synthase 1, peroxisomal OS=Arabidopsis thaliana E-value=4e-18; Citrate synthase, peroxisomal OS=Dictyostelium discoideum E-value=5e-07; |
Length | 397 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtRHE; |
Sequence | CACAAACACAAGAACACAAACATCGTACAACAATGTCAACGACAACAACAACGGAATCGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818879 |
Trichome-related Gene from Literature | N/A |