Detail of EST/Unigene AA660210 |
Acc. | AA660210 |
Internal Acc. | 00051 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Citrate synthase, mitochondrial OS=Solanum tuberosum E-value=2e-12; Citrate synthase, mitochondrial OS=Citrus maxima E-value=2e-09; Citrate synthase 4, mitochondrial OS=Arabidopsis thaliana E-value=2e-09; Citrate synthase, mitochondrial OS=Daucus carota E-value=4e-07; Citrate synthase 5, mitochondrial OS=Arabidopsis thaliana E-value=2e-06; |
Length | 493 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtRHE; |
Sequence | TTTTCTCTTCTCAGTATAAAGACCAGTTCAATTTTCCTATTTTTTTTGGATCCGTAATCA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819042 |
Trichome-related Gene from Literature | N/A |