| Detail of EST/Unigene AA660210 |
| Acc. | AA660210 |
| Internal Acc. | 00051 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Citrate synthase, mitochondrial OS=Solanum tuberosum E-value=2e-12; Citrate synthase, mitochondrial OS=Citrus maxima E-value=2e-09; Citrate synthase 4, mitochondrial OS=Arabidopsis thaliana E-value=2e-09; Citrate synthase, mitochondrial OS=Daucus carota E-value=4e-07; Citrate synthase 5, mitochondrial OS=Arabidopsis thaliana E-value=2e-06; |
| Length | 493 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtRHE; |
| Sequence | TTTTCTCTTCTCAGTATAAAGACCAGTTCAATTTTCCTATTTTTTTTGGATCCGTAATCA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 819042 |
| Trichome-related Gene from Literature | N/A |