Detail of EST/Unigene AA660574 |
Acc. | AA660574 |
Internal Acc. | 00460 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein 1, chloroplastic OS=Sinapis alba E-value=8e-36; Chlorophyll a-b binding protein 1, chloroplastic OS=Arabidopsis thaliana E-value=7e-35; Chlorophyll a-b binding protein 3, chloroplastic OS=Arabidopsis thaliana E-value=3e-34; Chlorophyll a-b binding protein 2, chloroplastic OS=Arabidopsis thaliana E-value=3e-34; Chlorophyll a-b binding protein, chloroplastic OS=Triticum aestivum E-value=5e-33; |
Length | 590 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtRHE; |
Sequence | GTACATTTATCAAAAGCACAACAAGCATTTTAATTTCATTGCAAAATGGCCGCATCATCC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 818006 |
Trichome-related Gene from Literature | N/A |