Detail of EST/Unigene AA660594 |
Acc. | AA660594 |
Internal Acc. | 00480 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Estradiol 17-beta-dehydrogenase 12-A OS=Danio rerio E-value=2e-15; Estradiol 17-beta-dehydrogenase 12 OS=Bos taurus E-value=2e-15; 3-ketoacyl-CoA reductase OS=Ustilago maydis (strain 521 / FGSC 9021) E-value=5e-15; Estradiol 17-beta-dehydrogenase 12 OS=Xenopus tropicalis E-value=6e-15; Putative steroid dehydrogenase let-767 OS=Caenorhabditis briggsae E-value=1e-14; |
Length | 582 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtRHE; |
Sequence | AATTTCTGTTGATTTTTCTGCTCATCTACCTTACCAGTACTACGATACCATTCCCACACT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00150 Androgen and estrogen metabolism > K00044 estradiol 17beta-dehydrogenase; ; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K10251 beta-keto reductase |
EC | 1.1.1.- 1.1.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843098 |
Trichome-related Gene from Literature | N/A |