Detail of EST/Unigene AA660657 |
Acc. | AA660657 |
Internal Acc. | 00545 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=2e-45; Vicianin hydrolase (Fragment) OS=Vicia sativa subsp. nigra E-value=3e-45; Furcatin hydrolase OS=Viburnum furcatum E-value=1e-42; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=3e-42; Beta-glucosidase 29 OS=Oryza sativa subsp. japonica E-value=4e-42; |
Length | 634 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtRHE; |
Sequence | GCTACTTGCTAATGGTCAAATACCATATGTGACCCTTTTTCATTGGGATCTTCCCCAGGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 832667 |
Trichome-related Gene from Literature | 832667 |