Detail of EST/Unigene AA660684 |
Acc. | AA660684 |
Internal Acc. | 00573 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Non-cyanogenic beta-glucosidase OS=Trifolium repens E-value=2e-62; Cyanogenic beta-glucosidase (Fragment) OS=Trifolium repens E-value=1e-60; Beta-glucosidase 27 OS=Oryza sativa subsp. japonica E-value=3e-57; Beta-glucosidase 24 OS=Oryza sativa subsp. japonica E-value=3e-55; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=2e-54; |
Length | 627 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MtRHE; |
Sequence | AATGAGGAATGTGATCAGACCACCCCCTCCAAAGAGAAAGAGACCACATTCGGAAATATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819053 |
Trichome-related Gene from Literature | N/A |