| Detail of EST/Unigene AA660982 |
| Acc. | AA660982 |
| Internal Acc. | 00879 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase 9 OS=Arabidopsis thaliana E-value=8e-21; Glucan endo-1,3-beta-glucosidase 8 OS=Arabidopsis thaliana E-value=1e-20; Glucan endo-1,3-beta-glucosidase 5 OS=Arabidopsis thaliana E-value=1e-16; Glucan endo-1,3-beta-glucosidase 6 OS=Arabidopsis thaliana E-value=4e-14; Glucan endo-1,3-beta-glucosidase OS=Triticum aestivum E-value=3e-10; |
| Length | 637 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MtRHE; |
| Sequence | CTTCCATCCAGATGGTGTGTTGCAAACCCCTTGAGTGATCTGACTAATGTAGTAAACCAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827429 |
| Trichome-related Gene from Literature | N/A |